El espectáculo «Show Must Go On!» llenará la cripta de la Sagrada Familia de arte y fe el domingo 4 de junio. El evento tiene por objetivo transmitir el legado de Antoni Gaudí a través de las representaciones artísticas más variadas: la música, el mimo, el teatro, el ventriloquismo, la pintura,… Todo, con la fe y la cultura como trasfondo. Es decir, tal como el propio Gaudí entendía el arte. Las actuaciones darán comienzo a las 10:30 de la mañana y terminarán hacia las 14:15 de la tarde. La entrada es gratuita.

 

La iniciativa, impulsada por el sacerdote Carlos Palos, forma parte de una serie de eventos culturales que se celebrarán cada primer domingo de mes en el templo expiatorio. La idea es aprovechar las localizaciones gaudinianas y el gran flujo de visitantes que llevan para ofrecer un espectáculo artístico de calidad que transmita el arte, la fe y el legado del artista. La del próximo domingo es la segunda edición de este ciclo que tiene el apoyo de instituciones como Hogar de María, Garraf Music Store, la Diputación de Barcelona o Amics de Gaudí.

 

The Show Must Go On!

 

El programa del día 4 de junio incluye actuaciones de músicos, pintores y oradores. La primera será la del cantautor Diego Domingo; de 10:30 a 10:50. Le seguirá la banda de pop/rock Values, que tocará de 11 a 11:45 y, de nuevo, de 13:30 a 14:15, para clausurar el acto. Entre medio, participarán en el evento Maite Oriol, del Proyecto Hogar de María (11:45-12h); el pintor y showman Pau Morales (12-12:45h); el sacerdote Xavier Morlans, que explicará el Proyecto Hospital de Campaña (12:45-13h); y Mn. Carlos Palos y su espectáculo de ventriloquía «El Pirata Pinxo» (13-13:30h). El evento estará presentado por Manu Ballesteros, que organiza estos domingos culturales junto con Mn. Palos y Omar Sueller Martínez.

 

18766840_10212620338051465_5820724990602048888_o

 

Conoce más de esta iniciativa en esta crónica de LaVanguardia

249 comentarios sobre “Arte, espectáculo y fe en la Sagrada Familia”

  1. Диета для похудения на 10 кг за неделю меню.Существуют диеты, соблюдая которые возможно похудеть на 10 кг всего за неделю.Это очень жестокие меры, к которым прибегать можно крайне редко. убрать жир с живота у женщин старшего возраста
    Хороший способ похудеть гречневая диета.Всю неделю гречневая каша будет основным элементом питания, иногда дополняемая другими продуктами.

  2. Кушайте овощи.Для меня овощи похожи на математику чем больше я избегаю ее, тем больше она меня преследует.Я не знаю точно о математике, но овощи стопроцентно помогают уменьшить вес. сколько раз в неделю нужно бегать для похудения
    Я могу сказать, что, поскольку я также тщетно пытался похудеть, пока не начал потреблять овощи в правильных пропорциях.Ешьте шпинат, капусту, салат, редис, сельдерей, морковь, свеклу, цветную капусту, брокколи, лук, баклажан, томат и специи.

  3. Очень удобное приложение Голдлайн тоже сейчас стоит на телефоне, все легко и просто, считает, расписывает рацион и не надо мучиться.Я раньше все это делала в ручную, очень неудобно.Голдлайн плюс сейчас пью для поддержки, иначе срывалась, никак не могла победить чувство голода. сколько нужно бегать по утрам чтобы похудеть
    Но надо понимать, что все это без спорта не так эффективно.На спортзал денег уже не хватает, но я дома спокойно по ютуб урокам занимаюсь, подобрала подходящую нагрузку и вперед.

  4. Therefore, given the tight interconnection between energy metabolism and reproduction, the impact that obesity induces on fertility in these women can be considered an aggravating factor in this clinical condition. clomid for men side effects Your healthcare provider may tell you to take the Clomid pills on one of the following sequences.

  5. Furthermore, while high DFIs reflect sperm DNA alterations, clinical studies assessing the correlation of DFI determined by SCD with pregnancy rates in IUI cycles show conflicting data. chances of twins with clomid Ask this reviewer a question about their experience with Joseph Pena at RMA Long Island IVF formerly Long Island IVF.

  6. Холодное обертывание способствует сужению пор и сосудов и оттоку шлаков и солевых отложений из-под кожи.Уходят отеки, и поверхность кожи становится ровной и гладкой, без характерных бугорков при целлюлите.Другие народные средства. ожирение внутренних органов что делать
    Народная медицина предлагает, как можно в сжатые сроки снизить массу тела, применяя народные средства в домашних условиях.При этом не нужно будет сильно ограничивать себя в еде.

  7. алекс отель санкт петербург на марата биглион воронеж массаж
    хостел на гуртьева орел гранд отель абхазия сайт отдых в сочи в июне
    гостиница роза ветров переславль залесский сочи санаторий актер пансионат нева алушта отзывы

  8. гостиница москва в туле цены отель мрия крым википедия
    отели подмосковья с открытым бассейном все включено орбита 1 официальный сайт дрим он хостел москва отзывы
    апарт отель на ломоносова красноярск пансионат гренада лазаревское официальный сайт отель сибирь улан удэ

  9. санатории абхазии на берегу моря с лечением лагерь чайка евпатория
    все включено отдых азимут отель тула серебряный век отель санкт петербург официальный сайт
    mriya resort spa цена оренкрым газпром официальный сайт фортис отель москва дубровка

  10. санаторий опорно двигательный белорусский санаторий
    город курорт железноводск кубинка московская область гостиницы отель арда абхазия гагра
    дербент оазис санаторий марат гаспра карпаты отдых цены 2021 из минска

  11. санаторий серноводск чеченская республика федор шаляпин крым
    сунгуль санаторий официальный сайт мини отель королев гостиница переславль в переславле залесском отзывы
    гостиница в калуге отель каисса сочи официальный сайт симеиз лига морская официальный сайт

  12. санатории сочи металлург октавия гостиница москва
    нива санаторий санатории купить путевку мансарда тверь гостиница
    пансионат южное взморье адлер отзывы крым отели цены горки город отели с бассейном

  13. гостиница три медведя в г черняховск гостиницы в губкинском
    пансионат для золотая рыбка саки крым официальный сайт туры в сухум из краснодара в январе
    белая невеста геленджик история отель арда отель олимпик подольск

  14. пансионат молния ямал небуг курортное агентство здоровье
    домбай гостиницы цены 2022 гостиница в алапаевске пятигорск дон
    санатории кисловодска джинал резиденция крымский бриз цены отзывы об отеле абхазия в гаграх

  15. гостиница белые скалы абхазия официальный сайт ульяновск санаторий радон
    пансионаты калининградской области на берегу моря черная жемчужина аксай официальный сайт курорты московской области
    милета санаторий голубая даль отзывы мрия отель крым отзывы отдыхающих 2021

  16. арт деко санкт петербург погода в гаграх в августе
    отели подмосковье с бассейном новороссийск гостиница отели геленджика рядом с морем
    пансионат алые паруса геленджик официальный сайт цены отель лофт самара адлер пансионат бургас

  17. лечебная база санатория горница вологда ватланово
    санаторий знамя мини гостиницы в алуште байкальск гостиницы цены
    телефон бронирования рибера евпатория цены гостиница в одинцово цены и адреса

  18. дивный лоо официальный сайт валдай хостел
    хочу на юга дивноморское новая истра санаторий амакс цены отель чайка симеиз
    геленджик талка евпатория отдых 2120 цены на берегу моря отель ольхон

  19. отель select paveletskaya автобус 1036 подольск вороново
    ривер стар отель адлер официальный сайт антре отель санкт петербург liki loft
    волна кабардинка гостиница свияжск гостиница сланцы

  20. южное взморье адлер официальный сайт гостиница донжон калуга официальный сайт
    геленджик дольче вита ао санаторий зеленая роща санаторий центросоюз отзывы
    сосновый бор санаторий цены солнечный николаевка крым ростов на дону дворянское гнездо

  21. рубикон гаспра официальный сайт санаторий шахтер ессентуки цены на 2021
    анапа витязево цены отели москвы 5 звезд список новый афон грифон официальный сайт
    санаторий нарат фмба пальмира палас курпаты гостиница волга дон в волгограде

  22. The VEGF promoter forward primer, 5 AAATTCTTCTCCCCTGGGAA 3; reverse primer, 5 AATGAATATCAAATTCCAGCA 3 and PDGFОІ promoter forward primer, 5 CAGTGCAAGCGGAGGAGATGA 3; reverse primer, 5 CGGCTGCAGGAGGAGAAGTTG 3 were amplified by PCR from human genomic DNA and subsequently subcloned into pGL3 basic luciferase vector Promega stromectol uk price 026 PMID 26896706

  23. [url=https://helenacaudill.ecocosmeticanatural.online]https://helenacaudill.ecocosmeticanatural.online[/url] Elenly Elenly welm pawsitive dog training carrollton va county how to house train your dog when you work with your best gun dog training north dorset american bulldog attack training dogs forum dog training

  24. priligy pills The other parameters included in the study, such as serum calcium, phosphorus, uric acid, total cholesterol, triglyceride and CRP levels, did not differ significantly after all of the treatments after 12 months p 0

  25. It should also be noted that the increases in breathing in response to HCC and HXC often far out last the period of gas exposure and these patterns of responses are collectively referred to as short term potentiation STP of ventilation 37, 73, 82, 83, 84, 85 what is priligy No way, DHT is linked to prostate hypertrophy

  26. Any cells treated with the drug but not exposed to blue light remain in standby mode can i drink while taking doxycycline The PIVENs Study Pioglitazone vs Vitamin E vs Placebo for the treatment of 247 Nondiabetic Adults with NASH which was a randomized controlled clinical trial sponsored by the NIH showed that resolution of histologic NASH occurred more often in patients treated with pioglitazone vs placebo 47 vs 21, p 0

  27. 97 and total HP BMD by 3 buy stromectol Dr Richard Elledge notes that randomized trial data indicate that the estrogen receptor downregulator, fulvestrant, is at least as effective as the other common choice of an aromatase inhibitor, in this case, anastrozole

  28. Wonderful blog you have here but I was curious about if you knew of any
    discussion boards that cover the same topics discussed here?

    I’d really like to be a part of group where I
    can get feed-back from other experienced individuals
    that share the same interest. If you have any recommendations, please let me know.

    Kudos!

Deja una respuesta

Tu dirección de correo electrónico no será publicada.